Assessment of colinearity between large cloned DNA fragments and genomic DNA.

Sequence-specific modification of genomic DNA by small DNA fragments.

Small DNA fragments have been used to modify endogenous genomic DNA in both human and mouse cells. This strategy for sequence-specific modification or genomic editing, known as small-fragment homologous replacement (SFHR), has yet to be characterized in terms of its underlying mechanisms. Genotypic and phenotypic analyses following SFHR have shown specific modification of disease-causing geneti...

Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions.

MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleo...

Rapid screening of cloned DNA fragments for specific mutations.

Rapid mapping of cloned DNA fragments on the Salmonella chromosome.

Genetic analysis in bacteria often involves mapping novel mutations. Traditionally, mapping has been performed using time-consuming methods such as conjugation and transductional analysis. However, an alternative strategy is to use physical mapping using restriction enzymes, which cleave bacterial chromosomal DNA at relatively few sites, generating DNA fragments that can be resolved by pulsed-f...

Shotgun DNA sequencing using cloned DNase I-generated fragments

A method for DNA sequencing has been developed that utilises libraries of cloned randomly-fragmented DNA. The DNA to be sequenced is first subjected to limit attach by a non-specific endonuclease (DNase I in the presence of Mn++), fractionated by size and cloned in a single-stranded phage vector. Clones are then picked at random and used to provide a template for sequencing by the dideoxynucleo...